Skip to main content

Main menu

  • Home
  • Content
    • Latest
    • Ahead of print
    • Archive
  • Info for
    • Authors
    • Reviewers
    • Subscribers
    • Institutions
    • Advertisers
  • About Us
    • About Us
    • Editorial Office
    • Editorial Board
  • More
    • Alerts
    • Feedback
    • Folders
    • Help
  • Other Publications
    • Saudi Medical Journal

User menu

  • My alerts
  • Log in

Search

  • Advanced search
Neurosciences Journal
  • Other Publications
    • Saudi Medical Journal
  • My alerts
  • Log in
Neurosciences Journal

Advanced Search

  • Home
  • Content
    • Latest
    • Ahead of print
    • Archive
  • Info for
    • Authors
    • Reviewers
    • Subscribers
    • Institutions
    • Advertisers
  • About Us
    • About Us
    • Editorial Office
    • Editorial Board
  • More
    • Alerts
    • Feedback
    • Folders
    • Help
  • Follow psmmc on Twitter
  • Visit psmmc on Facebook
  • RSS
Case ReportCase Report
Open Access

Spinocerebellar ataxia type 8 presents as progressive supranuclear palsy

Lina Jiang, Weigang Zhu, Guohua Zhao and Lanxiao Cao
Neurosciences Journal July 2023, 28 (3) 199-203; DOI: https://doi.org/10.17712/nsj.2023.3.20230032
Lina Jiang
From the Department of Radiology (Jiang), Department of Clinical Laboratory (Zhu), and from the Department of Neurology (Zhao, Cao), the Fourth Affiliated Hospital, Zhejiang University School of Medicine, Yiwu, China
MD
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Weigang Zhu
From the Department of Radiology (Jiang), Department of Clinical Laboratory (Zhu), and from the Department of Neurology (Zhao, Cao), the Fourth Affiliated Hospital, Zhejiang University School of Medicine, Yiwu, China
MD
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Guohua Zhao
From the Department of Radiology (Jiang), Department of Clinical Laboratory (Zhu), and from the Department of Neurology (Zhao, Cao), the Fourth Affiliated Hospital, Zhejiang University School of Medicine, Yiwu, China
MD
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Lanxiao Cao
From the Department of Radiology (Jiang), Department of Clinical Laboratory (Zhu), and from the Department of Neurology (Zhao, Cao), the Fourth Affiliated Hospital, Zhejiang University School of Medicine, Yiwu, China
MD
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • ORCID record for Lanxiao Cao
  • For correspondence: [email protected]
  • Article
  • Figures & Data
  • eLetters
  • Info & Metrics
  • References
  • PDF
Loading

Article Figures & Data

Figures

  • Tables
  • Figure 1
    • Download figure
    • Open in new tab
    • Download powerpoint
    Figure 1

    - Genetic analysis of the patient. A) The pedigree of the patient’s family. B) The amplification procedure of polymerase chain reaction. C) The genetic test revealed that one allele of ATXN8OS gene had more than 131 CTA/CTG repeats.

  • Figure 2
    • Download figure
    • Open in new tab
    • Download powerpoint
    Figure 2

    - Brain MRI T2-weighted images of the patient. A) Axial brain MRI demonstrated midbrain atrophy B) No significant pontine atrophy. C) No significant cerebellar atrophy. D) Saggital image revealed hummingbird sign, the midbrain to pons ratio was 0.44 (yellow arrows).

  • Figure 3
    • Download figure
    • Open in new tab
    • Download powerpoint
    Figure 3

    -A timeline showing the progression of patient symptoms, diagnosis, and treatment. PSP: progressive supranuclear palsy.

Tables

  • Figures
    • View popup
    Table 1

    - Primer sequences used in PCR for this study.

    GenesPrimer(5’-3’)
    SCA1-FGGGTGATGAGCCCCGGA
    SCA1-RGGAGGCCTATTCCACTCTGC
    SCA2-FTGCGAGCCGGTGTATGGG
    SCA2-RCGGGCGACGCTAGAAGGC
    SCA3-FCCAGTGACTACTTTGATTCG
    SCA3-RTGGCCTTTCACATGGATGTGAA
    SCA6-FCACGTGTCCTATTCCCCTGTGATCC
    SCA6-RTGGGTACCTCCGAGGGCCGCTGGTG
    SCA7-FTGTTACATTGTAGGAGCGGAA
    SCA7-RCACGACTGTCCCAGCATCACTT
    SCA8-FCCCAATTCCTTGGCTAGACCC
    SCA8-RCAAGAGAGAGCAACTAACTCAACATC
    SCA12-FTGCTGGGAAAGAGTCGTG
    SCA12-RGCCAGCGCACTCACCCTC
    SCA17-FTTATGGCACTGGACTGACCC
    SCA17-RGTGAGTGGAAGAGCTGTGGT
    DRPLA-FCCCAGTCCACCGCCCACCCACCA
    DRPLA-RTGCTCCAGGAGGAGGGGGCCCAGA
    SCA36-FCCATGGTGAGGAGTGGTTGC
    SCA36-RTCAAACAGCACGTGCAACAG
PreviousNext
Back to top

In this issue

Neurosciences Journal: 28 (3)
Neurosciences Journal
Vol. 28, Issue 3
1 Jul 2023
  • Table of Contents
  • Cover (PDF)
  • Index by author
Print
Download PDF
Email Article

Thank you for your interest in spreading the word on Neurosciences Journal.

NOTE: We only request your email address so that the person you are recommending the page to knows that you wanted them to see it, and that it is not junk mail. We do not capture any email address.

Enter multiple addresses on separate lines or separate them with commas.
Spinocerebellar ataxia type 8 presents as progressive supranuclear palsy
(Your Name) has sent you a message from Neurosciences Journal
(Your Name) thought you would like to see the Neurosciences Journal web site.
Citation Tools
Spinocerebellar ataxia type 8 presents as progressive supranuclear palsy
Lina Jiang, Weigang Zhu, Guohua Zhao, Lanxiao Cao
Neurosciences Journal Jul 2023, 28 (3) 199-203; DOI: 10.17712/nsj.2023.3.20230032

Citation Manager Formats

  • BibTeX
  • Bookends
  • EasyBib
  • EndNote (tagged)
  • EndNote 8 (xml)
  • Medlars
  • Mendeley
  • Papers
  • RefWorks Tagged
  • Ref Manager
  • RIS
  • Zotero
Share
Spinocerebellar ataxia type 8 presents as progressive supranuclear palsy
Lina Jiang, Weigang Zhu, Guohua Zhao, Lanxiao Cao
Neurosciences Journal Jul 2023, 28 (3) 199-203; DOI: 10.17712/nsj.2023.3.20230032
Twitter logo Facebook logo Mendeley logo
  • Tweet Widget
  • Facebook Like
  • Google Plus One
Bookmark this article

Jump to section

  • Article
    • Abstract
    • Case Report
    • Discussion
    • Acknowledgement
    • References
  • Figures & Data
  • eLetters
  • References
  • Info & Metrics
  • PDF

Related Articles

  • No related articles found.
  • PubMed
  • Google Scholar

Cited By...

  • Polyserine peptides are toxic and exacerbate tau pathology in mice
  • Google Scholar

More in this TOC Section

  • Unmasking the mimic: Leprosy neuropathy misdiagnosed as chronic inflammatory demyelinating polyneuropathy: A case report from Saudi Arabia
  • Seminal vesicle schwannoma with chronic hemorrhage
  • Marchiafava-Bignami disease post-bariatric surgery: A case report and review of similar cases
Show more Case Report

Similar Articles

Navigate

  • home

More Information

  • Help

Additional journals

  • All Topics

Other Services

  • About

© 2025 Neurosciences Journal Neurosciences is copyright under the Berne Convention and the International Copyright Convention. All rights reserved. Neurosciences is an Open Access journal and articles published are distributed under the terms of the Creative Commons Attribution-NonCommercial License (CC BY-NC). Readers may copy, distribute, and display the work for non-commercial purposes with the proper citation of the original work. Electronic ISSN 1658-3183. Print ISSN 1319-6138.

Powered by HighWire